View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0890_low_16 (Length: 230)

Name: NF0890_low_16
Description: NF0890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0890_low_16
NF0890_low_16
[»] chr7 (1 HSPs)
chr7 (7-209)||(27445689-27445887)


Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 209
Target Start/End: Complemental strand, 27445887 - 27445689
Alignment:
7 ctcacatcctttggtcctgctaccacatcatcacttaatgccactagagcattagatgctacccccacgaagctagaaatttttatgttggtagggacga 106  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||   ||    
27445887 ctcacatcctttggtcccgctaccacatcatcacttaatgccactagtgcattagatgctacccccacgaagctagaaatttttatgttggtagg---ga 27445791  T
107 tcaactcttctannnnnnnngcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta 206  Q
    ||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27445790 tcaactcttcta-tttttttgcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta 27445692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 258 times since January 2019
Visitors: 6714