View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0891_low_10 (Length: 264)
Name: NF0891_low_10
Description: NF0891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0891_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 36170846 - 36170986
Alignment:
| Q |
1 |
agaagaggaaattgtggaggaaacagacgaagggttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170846 |
agaagaggaaattgtggaggaaacagacgaagggttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgatt |
36170945 |
T |
|
| Q |
101 |
gagatgatcaaagagaaacatatcagtcagccagaagaaat |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170946 |
gagatgatcaaagagaaacatatcagtcagccagaagaaat |
36170986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 35 - 141
Target Start/End: Original strand, 5294798 - 5294904
Alignment:
| Q |
35 |
ttagatagttttgctgttgtcaagtgttctttggatccacaacaagattttagagattcaatgattgagatgatcaaagagaaacatatcagtcagccag |
134 |
Q |
| |
|
||||||||||||||||| | || ||||| | ||||| | || ||||||||||||||||||||||||||||| |||||||||| || ||| || ||| |
|
|
| T |
5294798 |
ttagatagttttgctgtgattaaatgttcatcaaatccaaagcaggattttagagattcaatgattgagatgattgaagagaaacagattagtaaggcag |
5294897 |
T |
|
| Q |
135 |
aagaaat |
141 |
Q |
| |
|
||||||| |
|
|
| T |
5294898 |
aagaaat |
5294904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1230 times since January 2019
Visitors: 6711