View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0891_low_6 (Length: 296)
Name: NF0891_low_6
Description: NF0891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0891_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 38 - 239
Target Start/End: Original strand, 4065528 - 4065729
Alignment:
| Q |
38 |
ctacagttaccggaatcatagattccggtatggaagttgttcttttgatctttttagtatttgggtcaaacccaaatctaccattcattgaaagtccaag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065528 |
ctacagttaccggaatcatagattccggtatggaagttgttcttttgatctttttagtatttgggtcaaacccaaatctaccattcattgaaagtccaag |
4065627 |
T |
|
| Q |
138 |
acttagttcaaagtcttcttcatccatttcttcagcagtatcaaaccgttggacaggcttcaccgtaggtaaaggtatgttacaacgacgacgatgattc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065628 |
acttagttcaaagtcttcttcatccatttcttcagcagtatcaaaccgttggacaggcttcaccgtaggtaaaggtatgttacaacgacgacgatgattc |
4065727 |
T |
|
| Q |
238 |
tc |
239 |
Q |
| |
|
|| |
|
|
| T |
4065728 |
tc |
4065729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1172 times since January 2019
Visitors: 6711