View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0891_low_8 (Length: 271)
Name: NF0891_low_8
Description: NF0891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0891_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 54 - 239
Target Start/End: Original strand, 30045658 - 30045844
Alignment:
Q |
54 |
ggttgtacgtaacaaggttgaagataaagactatatagaactccaagttgatctcttattatcttgaaactggtggtgtacgtttgtttgtggaattgtt |
153 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
30045658 |
ggttgtacgtaataaggttgaagataaagactatatagaactccaagttgatctcatattatcttgaaactggtggtatacgtttgtttgtggaattgtt |
30045757 |
T |
 |
Q |
154 |
ttcttgacatgtatttgt-gaattgttcgttgtgagatatttcttccccgaaaataaaagaataaagatagcttctgtaaccatatt |
239 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30045758 |
ttcttgacatgtatttgtggaattgttcgttgtgagatatttcttccccgaaaataaaagaataaagatagcttctgtaaccatatt |
30045844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 50 - 174
Target Start/End: Complemental strand, 29990359 - 29990233
Alignment:
Q |
50 |
gtttggttgtacgtaacaaggttgaagataaagactatatagaactccaagttgatctcttattatcttgaaactggtggtgtac--gtttgtttgtgga |
147 |
Q |
|
|
||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| | |
|
|
T |
29990359 |
gtttggttgtacgtaacaatgttgaagttgaagactatatagaactccaagttgatctcttattatcttgaaactcgtgatgtacgtgtttgtttgtgaa |
29990260 |
T |
 |
Q |
148 |
attgttttcttgacatgtatttgtgaa |
174 |
Q |
|
|
|||||||| ||| ||||| |||||||| |
|
|
T |
29990259 |
attgtttttttggcatgtgtttgtgaa |
29990233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 30005469 - 30005413
Alignment:
Q |
80 |
aagactatatagaactccaagttgatctcttattatcttgaaactggtggtgtacgt |
136 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||| |
|
|
T |
30005469 |
aagactatatagaactccaagttaatctcagattatcttgaaaccggtggtgtacgt |
30005413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 87 - 136
Target Start/End: Original strand, 30071520 - 30071569
Alignment:
Q |
87 |
tatagaactccaagttgatctcttattatcttgaaactggtggtgtacgt |
136 |
Q |
|
|
|||| |||| ||||||||||||||||||||||||| | |||||||||||| |
|
|
T |
30071520 |
tatacaactacaagttgatctcttattatcttgaagccggtggtgtacgt |
30071569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 257 times since January 2019
Visitors: 6695