View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0892_low_12 (Length: 215)
Name: NF0892_low_12
Description: NF0892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0892_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 41097915 - 41098081
Alignment:
| Q |
1 |
gggaggtgagttggtttaaggagaaggtggtttgaaagattggagatgggtagaacacctcattttagtgtcatccttggttagagagcgggtgcctgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||| ||||||| | |
|
|
| T |
41097915 |
gggaggtgagttggtttaaggagaaggtggtttgaaagattggagatgggtagagcacctcattttaatgtcatccttggttagagggcgagtgcctgcg |
41098014 |
T |
 |
| Q |
101 |
tcttagattttagcgtctatattatttagttgatgattgatgtgttaccgtaacgaagaagcagagg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41098015 |
tcttagattttagcgtctatattatttagttgatgattgatgtgttaccgtaacgaagaagcagagg |
41098081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University