View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0893_low_13 (Length: 231)

Name: NF0893_low_13
Description: NF0893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0893_low_13
NF0893_low_13
[»] chr3 (1 HSPs)
chr3 (46-218)||(10797147-10797319)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 46 - 218
Target Start/End: Complemental strand, 10797319 - 10797147
Alignment:
46 gagtggaggtggtggtggtgggggagacgacggtggaggtgaggaagaggaagaaagggacagaaatagagaagaggcaatgctggttttggctgaggtt 145  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
10797319 gagtggaggtggtggtggtgggggagacgacggtggaggtggggaagaggaagaaagggacagaaatagagaagaggcaatgctggttttagctgaggtt 10797220  T
146 ggaaggtcaatggagagttttccggcggatttggctgttgctgttaaggcagggagggggccgggttcgatag 218  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||    
10797219 ggaaggtcaatggagagttttccggtggatttggctgttgctgttaaggcagggagggtgccgggttcgatag 10797147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University