View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0893_low_13 (Length: 231)
Name: NF0893_low_13
Description: NF0893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0893_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 46 - 218
Target Start/End: Complemental strand, 10797319 - 10797147
Alignment:
| Q |
46 |
gagtggaggtggtggtggtgggggagacgacggtggaggtgaggaagaggaagaaagggacagaaatagagaagaggcaatgctggttttggctgaggtt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10797319 |
gagtggaggtggtggtggtgggggagacgacggtggaggtggggaagaggaagaaagggacagaaatagagaagaggcaatgctggttttagctgaggtt |
10797220 |
T |
 |
| Q |
146 |
ggaaggtcaatggagagttttccggcggatttggctgttgctgttaaggcagggagggggccgggttcgatag |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10797219 |
ggaaggtcaatggagagttttccggtggatttggctgttgctgttaaggcagggagggtgccgggttcgatag |
10797147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University