View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0893_low_6 (Length: 297)
Name: NF0893_low_6
Description: NF0893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0893_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 66 - 267
Target Start/End: Original strand, 12475057 - 12475258
Alignment:
| Q |
66 |
gacatcatcacttgtgtattttttgggacagggattaccttggacagtatgaaaggtcaataaaaatttcatagatgattaaattcttttggcatcagag |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12475057 |
gacatcatcacttgtgtattttttgggacagagattaccttggacagtatgaaaggtcaataaaaatttcatagatgattaaattcttttggcatcagaa |
12475156 |
T |
|
| Q |
166 |
gaaagaagacccatctgctctgttagttgatccaggggttgagtattattgtcccatccattttctgttggctgcacctcattccctctggatatctcgt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12475157 |
gaaagaagacccatctgctctgttagttgatccaggggttgagtattattgtcccatccattttctgttggctgcacctcattccctctggatatctcgt |
12475256 |
T |
|
| Q |
266 |
ct |
267 |
Q |
| |
|
|| |
|
|
| T |
12475257 |
ct |
12475258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 270 times since January 2019
Visitors: 6714