View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0893_low_8 (Length: 280)
Name: NF0893_low_8
Description: NF0893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0893_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 62 - 193
Target Start/End: Complemental strand, 18978515 - 18978384
Alignment:
| Q |
62 |
ctaacaacaaagaagtgtctcttaaacaatgcttcttattctgatggtttacttgttaatgagacccattaaacccgaatatccatttttacattccaaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
18978515 |
ctaacaacaaagaagtgtctcttaaacaatgctccttattctgatggtttacttgttagtgagacccattaaatccgaaaatccatttttacattccaaa |
18978416 |
T |
|
| Q |
162 |
aaattgtaggatattctcacgcttcaaacttt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18978415 |
aaattgtaggatattctcacgcttcaaacttt |
18978384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 206
Target Start/End: Original strand, 19028218 - 19028299
Alignment:
| Q |
125 |
acccattaaacccgaatatccatttttacattccaaaaaattgtaggatattctcacgcttcaaactttttgtctagcttta |
206 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||| | |||| |||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
19028218 |
acccattaagcccgaatacccatttttacattccgaaaattcttagggtattctcatgctttaaactttgtgtctaacttta |
19028299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 331 times since January 2019
Visitors: 6696