View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0894_low_10 (Length: 285)
Name: NF0894_low_10
Description: NF0894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0894_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 43 - 228
Target Start/End: Complemental strand, 45062809 - 45062624
Alignment:
Q |
43 |
agcagagagttttctgtattggtagataggtctgtgggtggttccagcatcgtagatggacaattggagctaatggttcataggtttgttatgcgcttat |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45062809 |
agcagagagttttctgtattggtagataggtctgtgggtggttccagcatcgtagatggacaattggagctaatggttcataggtttgttatgcgcttat |
45062710 |
T |
 |
Q |
143 |
gctcattatgtatcactctatattataccaatcaattaacattcaannnnnnnacccttttatgtaggaggttacttgttgatgat |
228 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
45062709 |
gctcgttatgtatcactctatattataccaatcaaataacattcaatttttttacccttttatgtaggaggttacttgttgatgat |
45062624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University