View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0894_low_9 (Length: 297)
Name: NF0894_low_9
Description: NF0894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0894_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 52 - 262
Target Start/End: Complemental strand, 46473449 - 46473248
Alignment:
Q |
52 |
gcaacaatattcatcaattatgttgtgtttcctggagtcgctagaaatcgttgtccaccactttaaagatgtcaatgttgtgcaagcccttttgccaagt |
151 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46473449 |
gcaacaatattcaccaattatgttgtgtttcct---------agaaatcgttgtccaccactttaaagatgtcaatgttgtgcaagcccttttgccaagt |
46473359 |
T |
 |
Q |
152 |
tgtccagcaatcagcattaataactttgagagtttatggttctgccgaatattcgaaaatgctagttcctcattctaaagtcaaaatggcagtagtgtgt |
251 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46473358 |
tgtccagcaatcagcattaataactttgagagtttatggttctgccgaatattcgaaaatgctagttcctcattctaaagtcaaaatggcagtagtgtgt |
46473259 |
T |
 |
Q |
252 |
gagatattatt |
262 |
Q |
|
|
||||||||||| |
|
|
T |
46473258 |
gagatattatt |
46473248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 910 times since January 2019
Visitors: 6705