View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0895_low_18 (Length: 261)
Name: NF0895_low_18
Description: NF0895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0895_low_18 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 24 - 261
Target Start/End: Complemental strand, 41001918 - 41001679
Alignment:
Q |
24 |
ccctccaccagccacaaccttcccatgttatctccctatctaatctaataaccttaactcaagttcagatcagtggaagaggcaaccgagttctccaata |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
41001918 |
ccctccaccagccacaaccttcccatgttatctccctatctaat--aataaccttaactcaagttcagatcagtggaagaggcaaccgagttctcaaata |
41001821 |
T |
 |
Q |
124 |
tatatagttatttcttgcattcatcttcgtatagtcatt----tcatcaaatattctagatattagcactccatggccgacgacaaaataccatcataat |
219 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
41001820 |
tatatagttttttcttgcattcatcttcgtatagtcattggcttcatcaaatattctagatattagcactccatggccgacgacaaaataccatcatagt |
41001721 |
T |
 |
Q |
220 |
ccttgcaattggggaaaaatagataaaaactaaaccgttact |
261 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
41001720 |
ccttgcaattggggaaaaataaataaaaactaaaccgttact |
41001679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University