View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0895_low_19 (Length: 252)
Name: NF0895_low_19
Description: NF0895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0895_low_19 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 57 - 252
Target Start/End: Original strand, 28030740 - 28030937
Alignment:
Q |
57 |
catatgcttcatcttcctttactggtaaaataggagaataacacattgttttagctctaacaaatatac--cattacaatctcgcatgtaaatgatttta |
154 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
28030740 |
catatgcttcatcttcctttactggtaaaataggagaataacacattgttttagctctaacaaatatacaccattataatctcgcatgtaaatgatttta |
28030839 |
T |
 |
Q |
155 |
gcttttcatcaaatggtttcatccacttaactacatttgcagagggtgatttccatacccttggtgctttactcatttgtgcccattgccattgtttt |
252 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28030840 |
gcttttcaacaaatggtttcatccacttaactacatttgcagagggtgatttccatacccttggtgctttactcatttgtgcccattgccattgtttt |
28030937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University