View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0895_low_20 (Length: 218)
Name: NF0895_low_20
Description: NF0895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0895_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 6316518 - 6316321
Alignment:
| Q |
1 |
ataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatatggttggataaatcattttaattgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316518 |
ataaaaccatcggtaataaacaaccttatgttgcaagatatgtacaaaacggtggctcattttttaactaatatggttggataaatcattttaattgtga |
6316419 |
T |
|
| Q |
101 |
tttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggaggaactagctttacacaaagtattgtgatgat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6316418 |
tttatgtgttgatttcatgcctctgccttgagtgtaatgtccattttgtgtatttagtatgatggaggaactagctttacacaaagtattgtgatgat |
6316321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 31 times since January 2019
Visitors: 6713