View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_high_40 (Length: 240)
Name: NF0896_high_40
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0896_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 24 - 87
Target Start/End: Original strand, 37436111 - 37436174
Alignment:
| Q |
24 |
tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatct |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37436111 |
tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatct |
37436174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 793 times since January 2019
Visitors: 6719