View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_20 (Length: 347)
Name: NF0896_low_20
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0896_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 40962347 - 40962564
Alignment:
Q |
1 |
aacgccttatcaatgaattggtctctacttagatgaaaattcaagtgagcttgagattttataatacatttcactggaatactccttcgggactgatatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40962347 |
aacgccttatcaatgaattggtctctacttagatgaaaattcaagtgagcttgagattttataatacatttcactggaatactccttcgggactgatatg |
40962446 |
T |
 |
Q |
101 |
atatgttattggctttcagtgtgcatctggtggagctagaaggaactggtcaatacttcgcaatgaaggctatggataagggagttatgctcaatcgcaa |
200 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40962447 |
atatgttatcggctttcagtgtgcatctggtggagctagaaggaactggtcaatacttcgcaatgaaggctatggataagggtgttatgctcaatcgcaa |
40962546 |
T |
 |
Q |
201 |
taaggttctgagtttgat |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
40962547 |
taaggttctgagtttgat |
40962564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 206
Target Start/End: Original strand, 22798227 - 22798317
Alignment:
Q |
116 |
tcagtgtgcatctggtggagctagaaggaactggtcaatacttcgcaatgaaggctatggataagggagttatgctcaatcgcaataaggt |
206 |
Q |
|
|
||||||| ||||| ||||||||| ||||||| |||| | || || |||||||||||||| |||| ||||||||||| || |||||||| |
|
|
T |
22798227 |
tcagtgtccatcttgtggagctatgtggaactgatcaacattttgccatgaaggctatggagaaggctgttatgctcaaccgtaataaggt |
22798317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 267 times since January 2019
Visitors: 6714