View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_21 (Length: 347)
Name: NF0896_low_21
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0896_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 40962371 - 40962139
Alignment:
Q |
1 |
gagaccaattcattgataaggcgtttatatattcacaagttccattaaggaaattgtagaatcactggaagtgacaatatcatggacatgtatgtagttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
T |
40962371 |
gagaccaattcattgataaggcgtttatatattcacaagttccattaaggaaattgtagaattactagaagtgacaatatcatggacatgtatgtagttt |
40962272 |
T |
 |
Q |
101 |
gtacttggaaaagagaactaaggagaaaaagagaaaaacaataaaccttccggtatctccagatcccaaaggtttaattggcctaaagtgctttaggctt |
200 |
Q |
|
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40962271 |
gtacttggaaaagagaa-----------------aaaaaaataaaccttccggtatctccagatcccaaaggtttaattggcctaaagtgctttaggctt |
40962189 |
T |
 |
Q |
201 |
atctgttctccattttcgatgatctgcaaaaccatagtgttgtctgtaac |
250 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
40962188 |
atctgttctccattttcgatgatctgcaaaaccatagtgttgtgtgtaac |
40962139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 235
Target Start/End: Complemental strand, 22797940 - 22797873
Alignment:
Q |
168 |
aaaggtttaattggcctaaagtgctttaggcttatctgttctccattttcgatgatctgcaaaaccat |
235 |
Q |
|
|
||||||||||||||| |||| ||||| | || ||||||||||||| | || ||||||||||||||||| |
|
|
T |
22797940 |
aaaggtttaattggcttaaaatgcttcaagcctatctgttctccactctccatgatctgcaaaaccat |
22797873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 674 times since January 2019
Visitors: 6718