View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_30 (Length: 308)
Name: NF0896_low_30
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0896_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 56313714 - 56313473
Alignment:
Q |
1 |
tgcatcatcatcaatccttcttcctcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctg |
100 |
Q |
|
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56313714 |
tgcataatcatcaatccttcttcttcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtgacatgatctg |
56313615 |
T |
 |
Q |
101 |
aattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattcccaatattttttc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
56313614 |
aattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattcccaata---tttc |
56313518 |
T |
 |
Q |
201 |
attttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56313517 |
attttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
56313473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University