View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_33 (Length: 286)
Name: NF0896_low_33
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0896_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 90 - 230
Target Start/End: Complemental strand, 11853246 - 11853106
Alignment:
| Q |
90 |
tacaagacgagcttgcacaaattgacaatcgttcatggaaaagaaaggtgactaatcgttcaacattgattcctctcaaaatgtggcctctttattttgc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11853246 |
tacaagacgagcttgcacaaattgacaatcgttcatggaaaagaaaggtgaccaatcgttcaacattgattcctctcaaaatgtggcctctttattttgc |
11853147 |
T |
|
| Q |
190 |
taacaattgataaattagaaacacgagatgagcttgcacca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11853146 |
taacaattgataaattagaaacacgagatgagcttgcacca |
11853106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 11853281 - 11853237
Alignment:
| Q |
22 |
catcatcattttgctaacgattgatatattagaaatacaagacga |
66 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11853281 |
catcttcattttgctaacaattgatatattagaaatacaagacga |
11853237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 11853299 - 11853229
Alignment:
| Q |
158 |
attcctctcaaaatgtggcctctttattttgctaacaattgataaattagaaacacgagatgagcttgcac |
228 |
Q |
| |
|
||||| ||||||| |||| |||| ||||||||||||||||||| |||||||| || ||| |||||||||| |
|
|
| T |
11853299 |
attccgctcaaaacatggcatcttcattttgctaacaattgatatattagaaatacaagacgagcttgcac |
11853229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 238 times since January 2019
Visitors: 6702