View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0896_low_33 (Length: 286)

Name: NF0896_low_33
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0896_low_33
NF0896_low_33
[»] chr7 (3 HSPs)
chr7 (90-230)||(11853106-11853246)
chr7 (22-66)||(11853237-11853281)
chr7 (158-228)||(11853229-11853299)


Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 90 - 230
Target Start/End: Complemental strand, 11853246 - 11853106
Alignment:
90 tacaagacgagcttgcacaaattgacaatcgttcatggaaaagaaaggtgactaatcgttcaacattgattcctctcaaaatgtggcctctttattttgc 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
11853246 tacaagacgagcttgcacaaattgacaatcgttcatggaaaagaaaggtgaccaatcgttcaacattgattcctctcaaaatgtggcctctttattttgc 11853147  T
190 taacaattgataaattagaaacacgagatgagcttgcacca 230  Q
    |||||||||||||||||||||||||||||||||||||||||    
11853146 taacaattgataaattagaaacacgagatgagcttgcacca 11853106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 11853281 - 11853237
Alignment:
22 catcatcattttgctaacgattgatatattagaaatacaagacga 66  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||    
11853281 catcttcattttgctaacaattgatatattagaaatacaagacga 11853237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 228
Target Start/End: Complemental strand, 11853299 - 11853229
Alignment:
158 attcctctcaaaatgtggcctctttattttgctaacaattgataaattagaaacacgagatgagcttgcac 228  Q
    ||||| |||||||  |||| |||| ||||||||||||||||||| |||||||| || ||| ||||||||||    
11853299 attccgctcaaaacatggcatcttcattttgctaacaattgatatattagaaatacaagacgagcttgcac 11853229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University