View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_36 (Length: 285)
Name: NF0896_low_36
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0896_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 148 - 250
Target Start/End: Complemental strand, 39108771 - 39108669
Alignment:
| Q |
148 |
cttaggccctttgtgctgaattaacagattgtaaaatggacgaaataatttttgctgtactacttgtgataaaaataattggtatgttatttggtttgat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39108771 |
cttaggccctttgtgctgaattaacagattgtaaaatggacgaaataatttttgctgtactacttgtgataaaaataattggtatgttgtttggtttgat |
39108672 |
T |
 |
| Q |
248 |
ttt |
250 |
Q |
| |
|
||| |
|
|
| T |
39108671 |
ttt |
39108669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 55 - 125
Target Start/End: Complemental strand, 39108869 - 39108799
Alignment:
| Q |
55 |
acatcatcaattaatattgtctcatacttaataactaagtgtgattttatagaactaagaagattctttcc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39108869 |
acatcatcaattaatattgtctcatacttaataactaagtgtgattttatagaactaagaagattctttcc |
39108799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University