View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_40 (Length: 260)
Name: NF0896_low_40
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0896_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26994948 - 26994727
Alignment:
Q |
1 |
ttccctgcaagcatgtaatgcagtgcatacatctgtcttctccaggaatttctctgcattttcaaataccaagggaccatactctagaacaatcttcttg |
100 |
Q |
|
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26994948 |
ttccttgcaagcatgtaatgcagtgcatatatctgtcttctccaggaatttctctgcattttcaaataccaagggaccatactctagaacaatcttcttg |
26994849 |
T |
 |
Q |
101 |
cactgcaaacattttgggagagtaacgnnnnnnnccaaatcagtcgatgagaaaaaaggttgattaggaaaattacatttacaaaatttcatacgagtcg |
200 |
Q |
|
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26994848 |
cactgcaaacatttcgggagagtaacgaaaaaaaccaaatcagtcgatgagaaaaaaggttgattaggaaaattacatttacaaaatttcatacgagtcg |
26994749 |
T |
 |
Q |
201 |
atacaattgacaaccatttttc |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
26994748 |
atacaattgacaaccatttttc |
26994727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University