View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0896_low_54 (Length: 206)
Name: NF0896_low_54
Description: NF0896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0896_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 6775432 - 6775584
Alignment:
Q |
1 |
ttgaagatggagaaggatctgtttttgttgctgatgaagtagtggggagtgttggaagttcaggaataggatctgattgtgaatatgatgaaaggatagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6775432 |
ttgaagatggagaaggatctgtttttgttgctgatgaagtagtggggagtgttggaagttcaggaataggatctgattgtgaatatgatgaaaggatagg |
6775531 |
T |
 |
Q |
101 |
tgaaggcatgaaaagcatgatgatcattagtactgaataaactgtgaatgatg |
153 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
T |
6775532 |
tgaaggcatgaaaaccatgatgatcattagtactgcagaaactgtgaatgatg |
6775584 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University