View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0897_high_2 (Length: 314)
Name: NF0897_high_2
Description: NF0897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0897_high_2 |
 |  |
|
| [»] scaffold1395 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 46 - 240
Target Start/End: Original strand, 43338612 - 43338806
Alignment:
| Q |
46 |
atcatcacatttgaattgttcaactctgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagct |
145 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43338612 |
atcatcacatttgaattgttcaactttgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagct |
43338711 |
T |
 |
| Q |
146 |
tcttggcaaagtagattgaaccagatggcataacagccttatagtaagttgaaaacttggctttcagagtgacgtttgacgtttcggcaacagct |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43338712 |
tcttggcgaagtagattgaaccagatggcatgacagccttatagtaagttgaaaacttggttttcagagtaacgtttgacgtttcggcaacagct |
43338806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 46 - 240
Target Start/End: Original strand, 43334177 - 43334371
Alignment:
| Q |
46 |
atcatcacatttgaattgttcaactctgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagct |
145 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43334177 |
atcatcacatttgaattgtccaactttgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagct |
43334276 |
T |
 |
| Q |
146 |
tcttggcaaagtagattgaaccagatggcataacagccttatagtaagttgaaaacttggctttcagagtgacgtttgacgtttcggcaacagct |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43334277 |
tcttggcgaagtagattgaaccagatggcatgacagccttatagtaagttgaaaacttggttttcagagtaacgtttgacgtttcggcaacagct |
43334371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1395 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: scaffold1395
Description:
Target: scaffold1395; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 66 - 237
Target Start/End: Original strand, 1 - 172
Alignment:
| Q |
66 |
caactctgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagcttcttggcaaagtagattgaa |
165 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1 |
caactttgccaatgcatctagctctttcccaaatttatcaagactactcactggaaataccttgtcacaccagttcagcttcttggcgaagtagattgaa |
100 |
T |
 |
| Q |
166 |
ccagatggcataacagccttatagtaagttgaaaacttggctttcagagtgacgtttgacgtttcggcaaca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||| ||||||| |
|
|
| T |
101 |
ccagatggcataacagccttatagtaagttgaaaacttgattttaagagtaacgtttgacgtttaggcaaca |
172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University