View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0897_low_2 (Length: 315)
Name: NF0897_low_2
Description: NF0897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0897_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 85 - 307
Target Start/End: Complemental strand, 46806148 - 46805926
Alignment:
| Q |
85 |
catcatcaccttcttgctttaactttgattccatataaacagttaatttagctttcaaatcaagcagcaaaccagaggctgcttccagtttagatttgag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46806148 |
catcatcaccttcttgctttaactttgattccatataaacagttaatttagctttcaaatcaagcagcaaaccagaggctgcttccagtttagatttgag |
46806049 |
T |
|
| Q |
185 |
atcctttgcagacaacatttgctcattgattctctggagctcttcttctgcctgtttaagttccttctcccaattgagtgaatcttgatctcttgccatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46806048 |
atcctttgcagacaacatttgctcattgattctctggagctcttcttctgcctgtttaagttccttctcccaattgagtgaatcttgatctcttgccatg |
46805949 |
T |
|
| Q |
285 |
actgttcctattctctgctcctc |
307 |
Q |
| |
|
|||||||||||||| || ||||| |
|
|
| T |
46805948 |
actgttcctattctttgttcctc |
46805926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 85 - 298
Target Start/End: Original strand, 5888734 - 5888947
Alignment:
| Q |
85 |
catcatcaccttcttgctttaactttgattccatataaacagttaatttagctttcaaatcaagcagcaaaccagaggctgcttcca-gtttagatttga |
183 |
Q |
| |
|
||||||| |||||||| ||| |||||||||||||||| || |||| | ||||||||||||||| ||||| |||| ||| | | | |||||||||| | |
|
|
| T |
5888734 |
catcatctccttcttggtttgactttgattccatataggcatttaactcagctttcaaatcaagaagcaacgcagaagctt-tactatgtttagatttaa |
5888832 |
T |
|
| Q |
184 |
gatcctttgcagacaacatttgctcattgattctctggagctcttcttctgcctgtttaagttccttctcccaattgagtgaatcttgatctcttgccat |
283 |
Q |
| |
|
||||| | ||| |||| |||| | ||||| | | | || |||| |||| | ||||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
5888833 |
gatccatagcaaacaaaattttttgattgagtttttctagttcttgttcttcttgttttagttccctctcccaattgagagaatcttgatctcttgccat |
5888932 |
T |
|
| Q |
284 |
gactgttcctattct |
298 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5888933 |
gactgttcctattct |
5888947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 925 times since January 2019
Visitors: 6707