View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0898_low_5 (Length: 349)
Name: NF0898_low_5
Description: NF0898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0898_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 30 - 343
Target Start/End: Original strand, 46499032 - 46499348
Alignment:
| Q |
30 |
tcatggataataattctcaagattgtgtaggaggatgtggaggtgtaaaaactttgcaacatcnnnnnnnnnnnnnnnnaccgtagatttttggagaatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46499032 |
tcatggataataattctcaagattgtgtaggaggatgtggaggtgtaaaaactttgcaacatttttttttttttttttaaccgtagatttttggagaatt |
46499131 |
T |
 |
| Q |
130 |
tagaatattattttaaattggttcggattttcttatgttttatcaaatgaactccatgatcatgcttttcaattttgaggtcgtca--tttgaattcaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46499132 |
tagaatattattttaaattggttcgtattttcttatgttttatcaaatgaactccatgatcatgcttttcaattttgaggtcgtcatttttgaattcaaa |
46499231 |
T |
 |
| Q |
228 |
gaaattgaaggaaatacttcaaaattatttgatttgtttgtgtttggcttttgtggaaagagaggaattccaaacatttttagcag-aaaaaatcatctg |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46499232 |
gaaattgaaggaaatacttcaaaattatttgatttgtttgtgtttggcttttgtggaaagagaggaattccaaacatttttagcagaaaaaaatcatctg |
46499331 |
T |
 |
| Q |
327 |
taatgcatattgttgga |
343 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
46499332 |
taatgcacattgttgga |
46499348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University