View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_high_21 (Length: 258)
Name: NF0899_high_21
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0899_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 28 - 224
Target Start/End: Original strand, 5847333 - 5847527
Alignment:
| Q |
28 |
atcaagtcatcgtagagtatatctgaacgaagagagttatagagacctaataatgtttgtcgtgtgtgaatatgaccagaaattcttatgaactgttcca |
127 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5847333 |
atcaagtcatcgtagagtatatctcaacgaagagagtta--gagacctaataatgtttgtcgtgtgtgaatatgaccagaaattcttatgaactgttcca |
5847430 |
T |
|
| Q |
128 |
tagagacaaaacaactaaacggctgatcctcgtgtactcttcacattcacaatctcccaatctttcaattcaatgaatttagcagagacagtacggc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5847431 |
tagagacaaaacaactaaacggctgatcctcgtgtactcttcacattcacaatctcccaatcttccaattcaatgaatttagcagagacagtacggc |
5847527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 863 times since January 2019
Visitors: 6719