View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_high_22 (Length: 251)
Name: NF0899_high_22
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0899_high_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 15674620 - 15674375
Alignment:
| Q |
6 |
ctccaagaatatcaaaatgccatcaatgatagttaactgtctttagatcacaatagcggttaattgtggctcattagcggttgccaactgcagtaaattg |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
15674620 |
ctccaaaaatatcaaaatgccatcaatgatagttaactgtctttagatcacaatagcggttacttgtggctcgttagctgttgccaactgcagtaaattg |
15674521 |
T |
 |
| Q |
106 |
tcgttcctaacattttctagacaatggcaacacacttcaacttttttcctcttccatctaaaaacatcaaatttcaaagttttttgtgcaaaatctaggt |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15674520 |
tcgttcctaacattttctagactatggcaacacacttcaacttttttcctcttccatctaaaaacctcaaatttcaaagttttttgtgcaaaatctaggt |
15674421 |
T |
 |
| Q |
206 |
ctcaaatcattgaagaatgaagaatgattgctacaagatttctaca |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||||| |
|
|
| T |
15674420 |
ctcaaatcattgaagaatgaattatgattgctagaaaatttctaca |
15674375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 210
Target Start/End: Original strand, 37893807 - 37893862
Alignment:
| Q |
154 |
ctcttccatctaaaaacatcaaatttcaaagttttttgtgcaaaatctaggtctcaa |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
37893807 |
ctcttccatctaaaaacaccaaatttcaaa-ttttttgtgcaaaatcttggtctcaa |
37893862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University