View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0899_high_25 (Length: 230)

Name: NF0899_high_25
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0899_high_25
NF0899_high_25
[»] chr5 (1 HSPs)
chr5 (1-230)||(38005793-38006022)
[»] chr3 (1 HSPs)
chr3 (8-230)||(26461791-26462013)


Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 38005793 - 38006022
Alignment:
1 gtgagtgtgttgcatgcgcgtagagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattat 100  Q
    |||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38005793 gtgagtttgtttcatgcgcgtatagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattat 38005892  T
101 aggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38005893 aggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctg 38005992  T
201 ggttggcggaggagggtggcgatttggttg 230  Q
    ||||||||||||||||||||||||||||||    
38005993 ggttggcggaggagggtggcgatttggttg 38006022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 26462013 - 26461791
Alignment:
8 tgttgcatgcgcgtagagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattataggtagg 107  Q
    |||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||| || || |||    
26462013 tgtttcatgcgcgtagagagctaaaagaacagcttcaaacccggcttgcggttttctatcagcgacgcgtgagaggtaaacaccggcgataatcgggagg 26461914  T
108 aaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctgggttggc 207  Q
    ||||| ||||||||||| |||||||||  || ||| |||||||||||||| |||||||||||||||||||||||||| || || |||||| |||||||||    
26461913 aaacgtaggacggtgagttggagatcagtgatatttgattggaaagtgtcgtagagccaacgacaaagattgttgtcaccggcgccggagttgggttggc 26461814  T
208 ggaggagggtggcgatttggttg 230  Q
    |||||||||||||||||||||||    
26461813 ggaggagggtggcgatttggttg 26461791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1454 times since January 2019
Visitors: 6712