View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_high_25 (Length: 230)
Name: NF0899_high_25
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0899_high_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 38005793 - 38006022
Alignment:
| Q |
1 |
gtgagtgtgttgcatgcgcgtagagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattat |
100 |
Q |
| |
|
|||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005793 |
gtgagtttgtttcatgcgcgtatagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattat |
38005892 |
T |
 |
| Q |
101 |
aggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005893 |
aggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctg |
38005992 |
T |
 |
| Q |
201 |
ggttggcggaggagggtggcgatttggttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38005993 |
ggttggcggaggagggtggcgatttggttg |
38006022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 26462013 - 26461791
Alignment:
| Q |
8 |
tgttgcatgcgcgtagagtgctaaaagaacggcttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattataggtagg |
107 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||| || || ||| |
|
|
| T |
26462013 |
tgtttcatgcgcgtagagagctaaaagaacagcttcaaacccggcttgcggttttctatcagcgacgcgtgagaggtaaacaccggcgataatcgggagg |
26461914 |
T |
 |
| Q |
108 |
aaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctgggttggc |
207 |
Q |
| |
|
||||| ||||||||||| ||||||||| || ||| |||||||||||||| |||||||||||||||||||||||||| || || |||||| ||||||||| |
|
|
| T |
26461913 |
aaacgtaggacggtgagttggagatcagtgatatttgattggaaagtgtcgtagagccaacgacaaagattgttgtcaccggcgccggagttgggttggc |
26461814 |
T |
 |
| Q |
208 |
ggaggagggtggcgatttggttg |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26461813 |
ggaggagggtggcgatttggttg |
26461791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University