View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_low_13 (Length: 357)
Name: NF0899_low_13
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0899_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 43341926 - 43341737
Alignment:
Q |
13 |
aatatagcaaagcaccaagactatttcgtgagttgtactaaaaacagaaaaatccaacttcaaatgtgtgtgtaataatcattttcgggacatcatttgt |
112 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43341926 |
aatatagcaaagcaccaagactattttgcgagttgtactaaaaacagaaaaatccaacttcaaatgtgtgtgtaataatcattttcgggacatcatttgt |
43341827 |
T |
 |
Q |
113 |
taagtggcaaaatatttttaaatttttaccaaaatacattatgtgagtcataataattatgtatatgactgtattacatcaattgctatt |
202 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43341826 |
taagtggcaaaatatgtttaaatttttaccaaaatacattatgtgagtcataataattatgtatatgactgtattacatcaattgctatt |
43341737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 249 - 328
Target Start/End: Complemental strand, 43341739 - 43341660
Alignment:
Q |
249 |
attaaacaaaaggaattaaaaaacaataaagatatgattacatatataatgctagtagtgcaacttgtgcaagcatgagg |
328 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
43341739 |
attaaaaaaaaggaattaaaaaacaataaagatatgattacatatataatgctagtagtgcaacttgtgcaagaatgagg |
43341660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 234 times since January 2019
Visitors: 6714