View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_low_24 (Length: 266)
Name: NF0899_low_24
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0899_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 37 - 242
Target Start/End: Complemental strand, 7500791 - 7500586
Alignment:
| Q |
37 |
gacatcatccagccctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttctgaccttcgccacttgatctgcaacaacg |
136 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7500791 |
gacatcatccagacctatatccttccacgcctcgatggggcagccttaatggcattgtcctgtgtatgttccgaccttcgccacttgatctgcaacaacg |
7500692 |
T |
 |
| Q |
137 |
aggaattatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttcctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500691 |
aggaattatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttcctt |
7500592 |
T |
 |
| Q |
237 |
catctc |
242 |
Q |
| |
|
| |||| |
|
|
| T |
7500591 |
cttctc |
7500586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 242
Target Start/End: Complemental strand, 7502118 - 7502019
Alignment:
| Q |
143 |
tatggcggaacatttgcacctccatgtggccttgccttctgcatccaaccgttagccacattatcaccactttccctggtggttaccgttccttcatctc |
242 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||| |||| || |||||| ||||| | | | ||| |||||||||| ||||||||| |||| ||| |||| |
|
|
| T |
7502118 |
tatggcggaatatttgcacctcaaagtggccttcccttatggatccaatcgttaacgatgtcatctccactttccccggtggttacagttcattcttctc |
7502019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 94 - 161
Target Start/End: Original strand, 27253110 - 27253177
Alignment:
| Q |
94 |
tcctgtgtatgttctgaccttcgccacttgatctgcaacaacgaggaattatggcggaacatttgcac |
161 |
Q |
| |
|
|||||||||| ||| || || |||||| |||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
27253110 |
tcctgtgtatcttcagaactccgccacatgatctgcaacaacgaagatctatggcggaacatatgcac |
27253177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University