View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0899_low_26 (Length: 263)
Name: NF0899_low_26
Description: NF0899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0899_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 15673287 - 15673064
Alignment:
Q |
1 |
aaaaggagctattttccaagacaaaatagcctatcatcattggtttttgctgggccaatccagctcgagtagtcccttaattacgatggtatatggaccc |
100 |
Q |
|
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
T |
15673287 |
aaaaagagcaattttccaagacaaaatagcctatcatcattggtttttgctgggccaatccagctcgagtagtcacttaattacgatgatatatggaccc |
15673188 |
T |
 |
Q |
101 |
tcgaaattgtactcctgctcccatattttgctaaaaatgatcagtttaccctcttgatacatgaa-----------tgtttttgctaaaccttcgcataa |
189 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
T |
15673187 |
tcgaaattgtactcctgcccccatattttgctaaaaatgatcagtttaccctcttgatacatgaatgttacatgaatgtttttgccaaaccttcacataa |
15673088 |
T |
 |
Q |
190 |
ccctatgagggctcttgataccaa |
213 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
15673087 |
ccctatgagggctcttgataccaa |
15673064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University