View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_11 (Length: 353)
Name: NF0900_high_11
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 25 - 332
Target Start/End: Original strand, 4676798 - 4677108
Alignment:
| Q |
25 |
ataatagtgttcatgtgagggtacctcagttagtacccgtctatttactagtatctatagcaaggatataagactttaattaaaaaactagttaagtttc |
124 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676798 |
ataatagtgttcatgtgagggtaactcagttagtacccgtctatccactagtatctatagcaaggatataagactttaattaaaaaactagttaagtttc |
4676897 |
T |
|
| Q |
125 |
atgataataagaacaatatcttaatagaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatattctcttttctttgc |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4676898 |
atgataataagaacaatatcttaataaaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatgttctcttttctttgc |
4676997 |
T |
|
| Q |
225 |
actttcctttacccttcccttgttttcattatttcttgttgtgacctat---ttatatatttccatcgctacagcctacatgtaccatttcaccgctcga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676998 |
actttcctttacccttcccttgttttcattatttcttggtgtgacctatttattatatatttccatcgctacagcctacatgtaccatttcaccgctcga |
4677097 |
T |
|
| Q |
322 |
gtattgttttt |
332 |
Q |
| |
|
||||||||||| |
|
|
| T |
4677098 |
gtattgttttt |
4677108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 181 times since January 2019
Visitors: 6702