View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_13 (Length: 313)
Name: NF0900_high_13
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 33 - 302
Target Start/End: Complemental strand, 14962443 - 14962175
Alignment:
| Q |
33 |
ttctttactttgtcccatgacatgaacatttcaagagctccaatatcattgaaatgcatcatgaaaaaagaaattgtatggaccacacacgtctttacga |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14962443 |
ttctttactttggcccatgacatgaacatttcaagagctccaatatcattgaaatgcatcatgaaaaaagaaattgtatggaccacacacgtctttatga |
14962344 |
T |
|
| Q |
133 |
accaagacaatatacaattgggaaccataatgtattatgaaaaatttatcaaaccattattaacnnnnnnnnnnnnnnnntgtgtcgctaacaacgtttc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
14962343 |
accaagacaatatacaattgggaaccataatgtattatgaaaaatttatcaaa-cattattaacaaaaaaggaaaaaaaatgtgtcgctaacaatgtttc |
14962245 |
T |
|
| Q |
233 |
tattttgttccctattaggttgcataacaaaataattataaagaattgcacgaggggattttagacctat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14962244 |
tattttgttccctattaggttgcataacaaaataattataaagaattgcacgaggggattttagacctat |
14962175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 320 times since January 2019
Visitors: 6702