View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_14 (Length: 289)
Name: NF0900_high_14
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 52 - 240
Target Start/End: Complemental strand, 4472020 - 4471832
Alignment:
| Q |
52 |
gaacctgtgctgtataaatattttcaagtacaataagcatgtgcaacacataagtggccaaattcaatgaaatataaaaaacaagtttaattaacacttc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472020 |
gaacctgtgctgtataaatattttcaagaacaataagcatgtgcaacacataagtggccaaattcaatgaaatataaaaaacaagtttaattaacacttc |
4471921 |
T |
|
| Q |
152 |
attggaacaaaatagaatccnnnnnnntacaagtcgaactttattgatgttacaaatcataattaaactactcgcttgtaattcctatg |
240 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4471920 |
attggaacaaaataaaatccaaaaaaatacaagtcgaactttattgatgttacaaatcgtaattaaactactcgcttgtaattcctatg |
4471832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 183 times since January 2019
Visitors: 6702