View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_16 (Length: 274)
Name: NF0900_high_16
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 24 - 243
Target Start/End: Complemental strand, 32079276 - 32079057
Alignment:
| Q |
24 |
tgcttatattgttcaaaaaagaagaagaatgcttataaggtatgatctcagtctctaccccatccgtcaaaaacatgaatcaatatggagcgtatgtctt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32079276 |
tgcttatattgttcaaaaaagaagaagaatgcttataaggtatgatctcagtctctaccccatccgtcaaaaacatgaatcaatatggagcatatgtctt |
32079177 |
T |
|
| Q |
124 |
ttgatttttaaggattggcatgcctttggagattcaagactacatatttggttacatgaaaagttaatgttattgaattaattaagagttactttggatt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32079176 |
ttgatgtttaaggattggcatgcctttggagattcaagactacatatttggttacatgaaaagttaatgttattgaattaattaagagttactttggatt |
32079077 |
T |
|
| Q |
224 |
ggtgaatttgggcctatgat |
243 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32079076 |
ggtgaatttgggcctatgat |
32079057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 855 times since January 2019
Visitors: 6699