View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_20 (Length: 266)
Name: NF0900_high_20
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 29 - 140
Target Start/End: Original strand, 13424462 - 13424574
Alignment:
Q |
29 |
gaatgtgtttgtaataataaaaagg-agatagcgtaattaaagatggatagttagacatcgtagaaaattggagagatctccatttgagaggatccgctc |
127 |
Q |
|
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
T |
13424462 |
gaatgtgtttgtaataataaaaagggagagagcgtaattaaagatggatagttagacatcgcagaaaattggagagatctccacttgagaggatccgctc |
13424561 |
T |
 |
Q |
128 |
ccgcatggtcttt |
140 |
Q |
|
|
||||||||||||| |
|
|
T |
13424562 |
ccgcatggtcttt |
13424574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 138 - 245
Target Start/End: Original strand, 13424794 - 13424901
Alignment:
Q |
138 |
tttactagtttgatctcta-gtgatcttcataatgaaaatcctctttaacgaatacaaatcctttgttgtgnnnnnnntaatttgttcaactatattggt |
236 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
13424794 |
tttactagtttgatctctaagtgatcttcataatgaaaatcctctttaacgaatacaaatcctttattgtg-aaaaaataatttgttcaactatattggt |
13424892 |
T |
 |
Q |
237 |
tcatctctc |
245 |
Q |
|
|
||||||||| |
|
|
T |
13424893 |
tcatctctc |
13424901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 255 times since January 2019
Visitors: 6702