View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_21 (Length: 265)
Name: NF0900_high_21
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 10151422 - 10151658
Alignment:
| Q |
1 |
tctctaggaagagatgctgctactggaagaggtgtcctctttgcgactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10151422 |
tctctaggaagagatgctgctactggaagaggtgtcctctttgcaactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtca |
10151521 |
T |
|
| Q |
101 |
tacaggtacnnnnnnnatattaccctaattagaaacactaactagttttaaatcgcggtcgtag-tgtgtcagattttacatattacgaagaatcatgat |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10151522 |
tacaggtactttttttatattaccctaattagaaacactaactagttttaaatcgcggtcgtagttgtgtcacattttacatattacgaagaatcatgat |
10151621 |
T |
|
| Q |
200 |
taaatgcagtcgatgcaatctaactcacggtcgtaga |
236 |
Q |
| |
|
||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
10151622 |
taaatgcagtcgatgcagtctaattcactgtcgtaga |
10151658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 33197375 - 33197478
Alignment:
| Q |
5 |
taggaagagatgctgctactggaagaggtgtcctctttgcgactgaggctttgcttaatgaatatggaaagagtgtatctggtcaacggtttgtcataca |
104 |
Q |
| |
|
|||| |||||||| ||||| |||||||| ||| | ||||| | ||||||||||||||||| || || |||||| ||||||| |||||||| ||||| || |
|
|
| T |
33197375 |
taggtagagatgcagctacaggaagaggagtcatgtttgcagcagaggctttgcttaatgagtacgggaagagtatatctggacaacggttcgtcattca |
33197474 |
T |
|
| Q |
105 |
ggta |
108 |
Q |
| |
|
|||| |
|
|
| T |
33197475 |
ggta |
33197478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 657 times since January 2019
Visitors: 6705