View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_29 (Length: 237)
Name: NF0900_high_29
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 28022876 - 28022982
Alignment:
| Q |
1 |
gtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaaagtttcacgatattggggcattccccttgatactttcacccttcatcgtctcaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022876 |
gtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaaagtttcacggtattggggcattccccttgatactttcacccttcatcgtctcaatg |
28022975 |
T |
|
| Q |
101 |
ttgaaat |
107 |
Q |
| |
|
||||||| |
|
|
| T |
28022976 |
ttgaaat |
28022982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 539 times since January 2019
Visitors: 6696