View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_high_31 (Length: 222)
Name: NF0900_high_31
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_high_31 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 2 - 120
Target Start/End: Original strand, 69070 - 69188
Alignment:
| Q |
2 |
acatattataaccaatcaaaggtctccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
69070 |
acatattataaccaatcaaaggtttccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
69169 |
T |
 |
| Q |
102 |
gaaaagaaaacatatattt |
120 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
69170 |
gaaaagaaaacatatattt |
69188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 2 - 120
Target Start/End: Original strand, 76913 - 77031
Alignment:
| Q |
2 |
acatattataaccaatcaaaggtctccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
101 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76913 |
acatattataaccaatcaaaggtttccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
77012 |
T |
 |
| Q |
102 |
gaaaagaaaacatatattt |
120 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
77013 |
gaaaagaaaacatatattt |
77031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University