View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_102 (Length: 211)
Name: NF0900_low_102
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_102 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 221680 - 221604
Alignment:
| Q |
1 |
acttcgattcctgaatacacaacatcattggcttccttactgacaccaatttccgaacatccctcctcttctctgct |
77 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
221680 |
acttcgattattgaatacacaacatcatcggcttcctttctaacaccaatttccgaacatccctcctcttctctgct |
221604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 296 times since January 2019
Visitors: 6702