View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_104 (Length: 209)
Name: NF0900_low_104
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_104 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 42444260 - 42444127
Alignment:
| Q |
1 |
gtaacactttttgctggctggcatggttatattatatatgtcatgattcatgtagtgtatatttattcttaagtcggcaacaatgattagtatttgtttt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42444260 |
gtaacactttttgctggctagcatggttatattatatatgtcatgattcatgtggtgtatatttattcttaagtcggcaacaatgactagtatttgtttt |
42444161 |
T |
|
| Q |
101 |
taaaaggttgttgttgtcttgttgttcctaccta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42444160 |
taaaaggttgttgttgtcttgttgttcctaccta |
42444127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 763 times since January 2019
Visitors: 6696