View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_107 (Length: 207)
Name: NF0900_low_107
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_107 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 47286885 - 47286973
Alignment:
| Q |
1 |
aagggccaaaatcggttcgatcgaaaattatgattttattgttgtgtgaaagttgcatgtgcatagctgaaatgccaatggttggttgt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286885 |
aagggccaaaatcggttcgatcgaaaattatgattttattgttgtgtgaaagttgcatgtgcatagctgaaatgccaatggttggttgt |
47286973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 92 times since January 2019
Visitors: 6700