View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_17 (Length: 396)
Name: NF0900_low_17
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 12 - 394
Target Start/End: Complemental strand, 39076098 - 39075716
Alignment:
Q |
12 |
atgaagacatgggaagattaagatggacacattttgatgatacacaaaatttatctttgtggtattatttatgttctctccttattgtaaccatttacat |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39076098 |
atgaagacatgggaagattaagatggacacattttgatgatacaaaaaatttatctttgtggtattatttatgttctctccttattgtaaccatttacat |
39075999 |
T |
 |
Q |
112 |
tggtgnnnnnnnnnnnnnnnnnaagcaattggaagtgggttcactacttccttcgaaccaatgctgctagatatatttaattattatcatgtattatttc |
211 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075998 |
tggtgttttttatgtgttttttaagcaattggaagtgggttcactacttccttcgaaccaatgctgctagatatatttaattattatcatgtattatttc |
39075899 |
T |
 |
Q |
212 |
gtgatatactttgctcaattaatacatggctttgtgctggattttgttttgattcttattgtatatttgcagggtagaaaaagcatagtttataggtcca |
311 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075898 |
gtgatatactttactcaattaatacatggctttgtgctggattttgttttgattcttattgtatatttgcagggtagaaaaagcatagtttataggtcca |
39075799 |
T |
 |
Q |
312 |
atataaagtaacaacagatatttcattcatgttcttgctaaaccatttcaagacaaacataatccatctagggcagttttgat |
394 |
Q |
|
|
|||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075798 |
atataaagtaacaatagatatttcattcatattcttgctaaaccacttcaagacaaacataatccatctagggcagttttgat |
39075716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 303 times since January 2019
Visitors: 6696