View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_19 (Length: 384)
Name: NF0900_low_19
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 10043878 - 10044028
Alignment:
Q |
95 |
tcttaaaaaatcagcagaatcatcaaaaataaaacggcgaccacacagctccaaattcatcattatttgccaacttttttggttttggagccgtaactat |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10043878 |
tcttaaaaaatcagcagaatcatcaaaaataaaacggcgaccacacagctccaaatttatcattatttgccaacttttttggttttggagccgtaactat |
10043977 |
T |
 |
Q |
195 |
tttggttctgtaggtctcttttggaacaccattctttgagatcttcttttt |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10043978 |
tttggttctgtaggtctcttttggaacaccattctttgagatcttcttttt |
10044028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 487 times since January 2019
Visitors: 6696