View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_27 (Length: 350)
Name: NF0900_low_27
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 183 - 335
Target Start/End: Complemental strand, 45616122 - 45615968
Alignment:
Q |
183 |
gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa |
280 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||| |
|
|
T |
45616122 |
gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa |
45616023 |
T |
 |
Q |
281 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattctt |
335 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45616022 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatattctt |
45615968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University