View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_28 (Length: 349)
Name: NF0900_low_28
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_28 |
 |  |
|
[»] scaffold0178 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0178 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 13 - 349
Target Start/End: Original strand, 13148 - 13484
Alignment:
Q |
13 |
tctaagaggctttgtagtgggaatgttaatagttctgatgttttgttgagtgttagggtttttgaatcggttttgcatgatgggtttaaagcggcgcata |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
T |
13148 |
tctaagaggctttgtagtgggaatgttaatagttgtgatgttttgttgagtgttagggttttcgaatcggttttgcatgatgggtttagagcggcgcata |
13247 |
T |
 |
Q |
113 |
agtttacgaagattttgattggtttgatgaggaaagcagggtgggatttaggtttagctgcgaatgcggttcatccgggtgttgtttattcgaaaaaagg |
212 |
Q |
|
|
|||| || ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
13248 |
agttcaccaagattttgattggtttgatgaggaaagccgggtgggatttaggtttagcggcgaatgcggttcatccaggtgttgtttattcgaaaaaagg |
13347 |
T |
 |
Q |
213 |
gcataatcagtatgcgcttttgtcgtatgtttgtttagggatgtttcaaggttttgattcggttagttttggattgagttcggagaaaagagacgaagaa |
312 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
13348 |
gcataatcagtatgcgcttttgtcgtatgtttgtttagggatgtttcaaggttttgatttggttagttttggattgagttcggagagaagagacgaagaa |
13447 |
T |
 |
Q |
313 |
gaattgatgtcgagtggtgagttttttgatttagatt |
349 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
13448 |
gaattgatgtcgagtggtgagttttttgatttagatt |
13484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University