View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0900_low_31 (Length: 323)

Name: NF0900_low_31
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0900_low_31
NF0900_low_31
[»] chr5 (1 HSPs)
chr5 (1-121)||(14965307-14965420)


Alignment Details
Target: chr5 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 14965307 - 14965420
Alignment:
1 catttgaaactacttagagaaaatgacgtgatgaacatgatgatgtccatctcattgacgattgtgtaattctgagattagctagccatttgaatcaaat 100  Q
    ||||||||||||||||||||||| |||||||||||||        || |||   ||||||||||||||||||||||||||||||| ||||||||||||||    
14965307 catttgaaactacttagagaaaacgacgtgatgaacaa-------tctatcatgttgacgattgtgtaattctgagattagctagtcatttgaatcaaat 14965399  T
101 ttcttcattaattagctcgtg 121  Q
    |||||||||||||||||||||    
14965400 ttcttcattaattagctcgtg 14965420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University