View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_31 (Length: 323)
Name: NF0900_low_31
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 14965307 - 14965420
Alignment:
| Q |
1 |
catttgaaactacttagagaaaatgacgtgatgaacatgatgatgtccatctcattgacgattgtgtaattctgagattagctagccatttgaatcaaat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || ||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14965307 |
catttgaaactacttagagaaaacgacgtgatgaacaa-------tctatcatgttgacgattgtgtaattctgagattagctagtcatttgaatcaaat |
14965399 |
T |
 |
| Q |
101 |
ttcttcattaattagctcgtg |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14965400 |
ttcttcattaattagctcgtg |
14965420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University