View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_33 (Length: 321)
Name: NF0900_low_33
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 38403763 - 38403806
Alignment:
| Q |
1 |
ttgttcgggattagtttgtttgctacaacaagcattttcttatt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38403763 |
ttgttcgggattagtttgtttgctacaacaagcattttcttatt |
38403806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 184 - 224
Target Start/End: Original strand, 38403947 - 38403987
Alignment:
| Q |
184 |
gtttttcatgacaaaaagtaaaggtaatatatgttgattgt |
224 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38403947 |
gtttttgatgacaaaaagtaaaggtaatatatgttgattgt |
38403987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University