View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_34 (Length: 319)
Name: NF0900_low_34
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0900_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 195 - 290
Target Start/End: Original strand, 12811018 - 12811113
Alignment:
Q |
195 |
tgaggtgtgttgcttaggatggggtgttggggaagaaggttggaagtggtagaggaggttatttgcttgagagaatgagcaaatgtgtactggttg |
290 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
12811018 |
tgagatgtgttgcttaggatggggtgttggggaagaaggttggaagtggtagaggaggttatttgcttgagagaatgagcaaatgtggacttgttg |
12811113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 79 - 199
Target Start/End: Complemental strand, 30596989 - 30596870
Alignment:
Q |
79 |
gaacgaaaggatagagaaaaggttgatagaaatttgaaannnnnnnctcagatttgtgaatatagaaaacggagttttgatttgtggtagagaaagagtt |
178 |
Q |
|
|
||||||||||| ||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| ||| |
|
|
T |
30596989 |
gaacgaaaggacagagaaagggttgatagaaatttgaaatttttt-ctcagatttgtgagtatagaaaacggatttttgatttgtggtagagaaacggtt |
30596891 |
T |
 |
Q |
179 |
gtcagggttgtgttgctgagg |
199 |
Q |
|
|
|||| |||| ||||| ||||| |
|
|
T |
30596890 |
gtcacggttatgttgatgagg |
30596870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University