View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_35 (Length: 318)
Name: NF0900_low_35
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_35 |
 | |
|
| [»] scaffold0036 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 77 - 186
Target Start/End: Original strand, 23011 - 23120
Alignment:
| Q |
77 |
caagaatataaaagaatgcatatttggcaaaagtataaatattggggagaagtggaatgaatggtttgtggtcattaaattgctctatttatagatttct |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23011 |
caagaatataaaagaatgcatatttggcaaaagtataaatattggggagaagtggaatgaatgggttgtggtcattaaattgctctatttatagatttct |
23110 |
T |
|
| Q |
177 |
tttagtacta |
186 |
Q |
| |
|
|||||||||| |
|
|
| T |
23111 |
tttagtacta |
23120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 180 - 280
Target Start/End: Original strand, 23391 - 23491
Alignment:
| Q |
180 |
agtactagttaatgagacttttcaaatgtgaaatatattcctccaacgaatataccactcatctatcccaaattataatataaatcattatgtaaaatat |
279 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23391 |
agtactaattaatgagacttttcaaatgtgaaatatattcctccaacgaatataccactcatctgtcccaaattataatataaatcattatgtaaaatat |
23490 |
T |
|
| Q |
280 |
t |
280 |
Q |
| |
|
| |
|
|
| T |
23491 |
t |
23491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #3
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 77 - 222
Target Start/End: Original strand, 15000 - 15140
Alignment:
| Q |
77 |
caagaatataaaagaatgcatatttggcaaaagtataaatattggggagaagtggaatgaatggtttgtggtcattaaattgc-tctatttatagatttc |
175 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||||||||| |||||||||| ||||||||||||||||||| || ||| |||||||||||||||| |
|
|
| T |
15000 |
caagaatataaaagcatgcatagttgataaaagtataaatataggggagaagttgaatgaatggtttgtggtc----aagtgcttctatttatagatttc |
15095 |
T |
|
| Q |
176 |
ttttagtactagttaatgagacttttcaaatgtgaaatatattcctc |
222 |
Q |
| |
|
||||||||||| ||||||||||||| | |||||| ||||||||||| |
|
|
| T |
15096 |
ttttagtacta--taatgagacttttgatatgtgagatatattcctc |
15140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 218 times since January 2019
Visitors: 6702