View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0900_low_48 (Length: 288)
Name: NF0900_low_48
Description: NF0900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0900_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 95 - 240
Target Start/End: Complemental strand, 17587893 - 17587747
Alignment:
| Q |
95 |
ttacaactttatcaaaatcaaattttttgactaaagcatagtcgagttgttctggtnnnnnnnnn-taacatctaacaaaacactcacatagaaattgaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17587893 |
ttacaactttatcaaaatcaaattttttgattaaagcataatcgagttgttctggtaaaaaaaaaataacatctaacaaaacactcacatagaaattgaa |
17587794 |
T |
 |
| Q |
194 |
gactccggctgcttcaggttttgctctttgctcgtccgtggtcctat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17587793 |
gactccggctgcttcaggttttgctctttgctcgtccgtggtcctat |
17587747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University